View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2878_high_6 (Length: 240)
Name: NF2878_high_6
Description: NF2878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2878_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 40006487 - 40006254
Alignment:
| Q |
1 |
taagtcctttgaaattttgataagctcataaataggtatggtgcacaaccatcttgagttttgaaagtactcgattggttttcttgaannnnnnnnnncg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40006487 |
taagtcctttgaaattttgataagcacataaataggtatggtgcacaaccgtcttgagttttgaaagtactcgattggttttcttgaattttttttttca |
40006388 |
T |
|
| Q |
101 |
tatataccatatcatacatttgatttctttccaattaatcttaataatttagaataaatagctaagctcgcagatgacaagac-ccccacaatcatcata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40006387 |
tatataccatatcatacatttgatttctttccaattaatcttaataatttagaataaatagctaagctcgcagatgacaagaccccccacaatcatcata |
40006288 |
T |
|
| Q |
200 |
ggcatagttgttgtgggaaactccctcttgctgt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40006287 |
ggcatagttgttgtgggaaactccctcttgctgt |
40006254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University