View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2878_high_8 (Length: 222)
Name: NF2878_high_8
Description: NF2878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2878_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 22 - 94
Target Start/End: Original strand, 4423814 - 4423886
Alignment:
| Q |
22 |
gttaaaactgcaattaaacctaaattaaattattgatccattgttatttcccgcgtcttctaaactccacaat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
4423814 |
gttaaaactgcaattaaacctaaattaaattattgatccattgttattttccgcgtcttcgaaactccacaat |
4423886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University