View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2878_low_12 (Length: 219)

Name: NF2878_low_12
Description: NF2878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2878_low_12
NF2878_low_12
[»] chr2 (1 HSPs)
chr2 (51-196)||(43637348-43637493)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 51 - 196
Target Start/End: Complemental strand, 43637493 - 43637348
Alignment:
51 aacaattgtcccaggaacatcaattagaatgacccttaaaaaatttgaatgaaagcaattgtttacagatactagcacaatcataccagtatacaccact 150  Q
    ||||||||  ||||||||||| || | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
43637493 aacaattgcaccaggaacatcgatcaaaatgacccttaaaaaatttcaatgaaagcaattgtttacagatactagcacaatcataccagtatacaccact 43637394  T
151 cagaaacataatcatgtcttaggttattatactactatatactata 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
43637393 cagaaacataatcatgtcttaggttattatactactatatactata 43637348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University