View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2879_high_2 (Length: 251)
Name: NF2879_high_2
Description: NF2879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2879_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 627604 - 627818
Alignment:
| Q |
14 |
gagagaaaagttagagagtgtgaaaagagtaagtgcaagaccgcgcaagtgttggttagtattattaatcaaagtcacggatgttagacctcatagagta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
627604 |
gagagaaaagttagagagtgtgaaaagagtaagtgcaagaccgcgcaagtgttggttggtattattaatcaaagtcacggatgttagacctcatagagta |
627703 |
T |
 |
| Q |
114 |
gtaaattagcacatagtattattatacggttggaggaagccaccctaagactctagttgctacttgtgaccaataaatacataactaattaatttacttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
627704 |
gtaaattagcacatagtattattatacggttggaggaagccaccctaagactctagttgctacttgtgaccaataaatacataactaattaatttacttt |
627803 |
T |
 |
| Q |
214 |
atcacttttatgttt |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
627804 |
atcacttttatgttt |
627818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University