View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880-Insertion-6 (Length: 146)
Name: NF2880-Insertion-6
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880-Insertion-6 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 2e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 45 - 146
Target Start/End: Complemental strand, 14546889 - 14546788
Alignment:
| Q |
45 |
taggccaaacactaattcacataaatgaattgcatgttgatgttcttttttaatggcaagtattatatataagagaaaaacattgaatgcccatggtttg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14546889 |
taggccaaacactaattcacataaatgaattgcatgtagatgttcttttttaatggaaaatattatatataagagaaaaacattgaatgcccgtggtttg |
14546790 |
T |
 |
| Q |
145 |
ag |
146 |
Q |
| |
|
|| |
|
|
| T |
14546789 |
ag |
14546788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 14546972 - 14546900
Alignment:
| Q |
7 |
ataaatgaagttggcacacaccttaaaagggatgtttctaggccaaacactaattcacataaatgaattgcat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14546972 |
ataaatgaagttggcacacaccttaaaagggatgtttctaggccaaacactaattcacataaatgaattgcat |
14546900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University