View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-23 (Length: 430)
Name: NF2880R-Insertion-23
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 53 - 430
Target Start/End: Complemental strand, 388270 - 387894
Alignment:
| Q |
53 |
taaatggtggtttgatgggactaattggtgatggtgatgacggcattgatctccacgatggttctctcttaatagttaccgaaggagaataataaggtgc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388270 |
taaatggtggtttgatgggactaattggtgatggtgatgacggcattgatctccacgatggttctctcttaatagttaccgaaggagaataataaggtgc |
388171 |
T |
|
| Q |
153 |
ggtactggaagtgtctgagaatgagaatggttttggagatggagagtatatttctccaacaagaagccgttctccgaagatggctacggcttctttgacg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388170 |
ggtactggaagtgtctgagaatgagaatggttttggagatggagagtatatttctccaacaagaagccgttctccgaagatggctacggcttctttgacg |
388071 |
T |
|
| Q |
253 |
gagctgaaaggacgagaggtgtccacggtggagctataatcagcggtaggggtcaccgacataggttcatgttccattgtannnnnnnnnnnnnnnnnnn |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388070 |
gagctgaaaggacgagaggtgtccacggtggagctataatcagcggtaggggtcaccgacataggttcatgttccattgta-tttgttttgtttgttgaa |
387972 |
T |
|
| Q |
353 |
nnaaggatatgggaattgttatgatcagtactagtatttgtttgaagccaggttggtgttttaattaattgttggttt |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
387971 |
ggaaggatatgggaattgttatgatcagtactagtatttgtttgaagccaggttggtgttttaattaattgttggttt |
387894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University