View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-24 (Length: 415)
Name: NF2880R-Insertion-24
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 9 - 180
Target Start/End: Complemental strand, 11734177 - 11734006
Alignment:
| Q |
9 |
gttcgtaaagaagctgagaattgtgattgcttgcaaggtaagtttggttataaattcatcctttttgtttttagccatgttgaatatgtattgttttgag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11734177 |
gttcgtaaagaagctgagaattgtgattgcttgcaaggtaagtttggttataaattcatcctttttgtttttagccatgttgaatatgtattgttttgag |
11734078 |
T |
|
| Q |
109 |
ataattgcagttgtgttgttagagaattgcgattgtgtcgttttatgttgtgagtttgtcggcagcttcatt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11734077 |
ataattgcagttgtgttgttagagaattgcgattgtgtcgttttatgttgtgagtttgtcggcagcttcatt |
11734006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 246 - 415
Target Start/End: Complemental strand, 11733940 - 11733771
Alignment:
| Q |
246 |
tacgaataaatatcgttttttagtagcaaatattaaatgattaaatgttgaactggtgttgttttcgagaaaattatgattgcttgcaaggtaatttttc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11733940 |
tacgaataaatatcgttttttagtagcaaatattaaatgattaaatgttgaactggtgttgttttcgagaaaattatgattgcttgcaaggtaatttttc |
11733841 |
T |
|
| Q |
346 |
cgttttatgctgtgagnnnnnnngcttattcatcctatttcttttttatcaatgttgaatttgtgttgtt |
415 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11733840 |
cgttttatgctgtgagtttttttgcttattcatcctatttcttttttatcaatgttgaatttgtgttgtt |
11733771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 53148169 - 53148129
Alignment:
| Q |
9 |
gttcgtaaagaagctgagaattgtgattgcttgcaaggtaa |
49 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53148169 |
gttcgtaaagaagcagagaattgtgattgcttgcaaggtaa |
53148129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 48
Target Start/End: Original strand, 5530791 - 5530824
Alignment:
| Q |
15 |
aaagaagctgagaattgtgattgcttgcaaggta |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
5530791 |
aaagaagctgagaattgtgattgcttgcagggta |
5530824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 5923011 - 5922978
Alignment:
| Q |
15 |
aaagaagctgagaattgtgattgcttgcaaggta |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
5923011 |
aaagaagctgagaattgtgattgcttgcagggta |
5922978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University