View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-27 (Length: 275)
Name: NF2880R-Insertion-27
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 275
Target Start/End: Original strand, 15559541 - 15559807
Alignment:
| Q |
13 |
ttgtgtttaggaataatccaaaagattacagaaacgaaagccgctaaactgaagaagagaatgaataaacacttgaaactgaaagctcttcgaatgaccg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559541 |
ttgtgtttaggaataatccaaaagattacagaaacgaaagccgctaaactgaaaaagagaatgaataaacacttgaaactgaaagctcttcgaatgaccg |
15559640 |
T |
 |
| Q |
113 |
aacaccgtgcaccttcatcgtcttgcctctgttcttcttgttgcacatgttcttcatcttttccaattttccccattgccaaagcatctggaa----nnn |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559641 |
aacaccgtgcaccttcatcgtcttgcctctgttcttcttgttgcacatgttcttcatcttttccaattttccccattgccaaagcatctggaatctctct |
15559740 |
T |
 |
| Q |
209 |
nnnnnnnnnnnnacaacgcgttgttatgatggtgctgttgctggtggttatgcctctctcactcttt |
275 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
15559741 |
ctctctctctctacaacgcgttgttatgatgttgttgttgctggtggttatgcctctctcactcttt |
15559807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University