View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-28 (Length: 272)
Name: NF2880R-Insertion-28
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 3601499 - 3601273
Alignment:
| Q |
9 |
gaatagctagctctgtatggttattttgttatannnnnnngagtgatgcattcatcaaaaattattttcccatgaaacgagccacgaatagtaaacaccc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3601499 |
gaatagctagctctgtatggttattttgttatatttttttgagtgatgcattcatcaaaaattattttcccatgaaacgagccacgaatagtaaataccc |
3601400 |
T |
 |
| Q |
109 |
tgatcattggtttgacagttgcnnnnnnnnnnnnnggcggccaaagccaacaagattaaatacatatttttgttgttgttgcaaatatccacttttcttt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3601399 |
tgatcattggtttgacagttgcaaaaaaaaaaaagggcggccaaagccaacaagattaaatacatatttttgttgttgttacaaatatccacttttcttt |
3601300 |
T |
 |
| Q |
209 |
tgtcagtctatcaaaacccttgatgca |
235 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
3601299 |
tgtcagtctatcaaaacccttggtgca |
3601273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University