View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-29 (Length: 240)
Name: NF2880R-Insertion-29
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-29 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 86 - 240
Target Start/End: Complemental strand, 238052 - 237898
Alignment:
| Q |
86 |
cataagtatgtccggtgatggattggactattcaattgcatgcatgttgagagttcttctctctactagtgtgtgtccatttggtcatataccattattt |
185 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
238052 |
cataagtatgtccggtgatggattagactattcaattgcatgcatgttgagagttcttctctctactagtgtgtgtccatttggtcatataccattattt |
237953 |
T |
|
| Q |
186 |
gtaacacaaagtaagagagggtcaactctcatactctaagtctctaacgacaatc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
237952 |
gtaacacaaagtaagagagggtcaactctcatactctaagtctctaacgacaatc |
237898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University