View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-3 (Length: 160)
Name: NF2880R-Insertion-3
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 5e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 5e-70
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 2625769 - 2625910
Alignment:
| Q |
8 |
aaatgtcttccactatttattctccatacatatgtcattacgtgaaacaattgcatatgaatgaggatatgccttcatctaacaatcaccaacacatgcg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625769 |
aaatgtcttccactatttattctccatacatatgtcattacgtgaaacaattgcgtatgaatgaggatatgccttcatctaacaatcaccaacacatgcg |
2625868 |
T |
 |
| Q |
108 |
ctttaatatagatttttggaacgatttattttatgtgtacag |
149 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2625869 |
ctttaatatagatttttgaaacgatttattttatgtgtacag |
2625910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University