View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-30 (Length: 229)
Name: NF2880R-Insertion-30
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 229
Target Start/End: Original strand, 47900807 - 47901028
Alignment:
| Q |
8 |
acaacgtttgttttaatgttgtggtgatgctggaataatgctatggaatttttgttgaagcttagttggattttgaaccgttagattgttacttgtgatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900807 |
acaacgtttgttttaatgttgtggtgatgctggaattatgctatggaatttttgttgaagcttagttggattttgaaccgttagattgttacttgtgatg |
47900906 |
T |
|
| Q |
108 |
gaatgttctaaacggaagattcgaatctttgcgttgttgttattttgtttgaaaattgaaagtgttagttgctttgctgagttgtttaatcattcgtggg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900907 |
gaatgttctaaacggaagattcgaatctttgcgttgttgttattttgtttgaaaattgaaagtgttagttgctttgctgagttgtttaatcattcgtggg |
47901006 |
T |
|
| Q |
208 |
gttccagttttgctgttgtgtc |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47901007 |
gttccagttttgctgttgtgtc |
47901028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University