View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880R-Insertion-6 (Length: 87)
Name: NF2880R-Insertion-6
Description: NF2880R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880R-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 9 - 87
Target Start/End: Complemental strand, 41785822 - 41785744
Alignment:
| Q |
9 |
cgacgttcattttctttatccaatccttcgcaaactgaacctcacaaagcattttagacacattgctcatgacacactc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785822 |
cgacgttcattttctttatccaatccttcgcaaactgaacctcacaaagcattttagacacattgctcatgacacactc |
41785744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 10835178 - 10835111
Alignment:
| Q |
14 |
ttcattttctttatccaatccttcgcaaactgaacctcacaaagcattttagacacattgctcatgacacac |
85 |
Q |
| |
|
|||||||||||||||| |||||| |||||| ||||||| || |||||||| ||| |||||||||||||| |
|
|
| T |
10835178 |
ttcattttctttatcctatccttagcaaaccgaacctc----agaattttagaaacactgctcatgacacac |
10835111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University