View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_high_34 (Length: 280)
Name: NF2880_high_34
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 65 - 257
Target Start/End: Complemental strand, 15559733 - 15559541
Alignment:
| Q |
65 |
ttccagatgctttggcaatggggaaaattggaaaagatgaagaacatgtgcaacaagaagaacagaggcaagacgatgaaggtgcacggtgttcggtcat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559733 |
ttccagatgctttggcaatggggaaaattggaaaagatgaagaacatgtgcaacaagaagaacagaggcaagacgatgaaggtgcacggtgttcggtcat |
15559634 |
T |
|
| Q |
165 |
tcgaagagctttcagtttcaagtgtttattcattctcttcttcagtttagcggctttcgtttctgtaatcttttggattattcctaaacacaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559633 |
tcgaagagctttcagtttcaagtgtttattcattctctttttcagtttagcggctttcgtttctgtaatcttttggattattcctaaacacaa |
15559541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 15559801 - 15559753
Alignment:
| Q |
1 |
tgagagaggcataaccaccagcaacagcaccatcataacaacgcgttgt |
49 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15559801 |
tgagagaggcataaccaccagcaacaacaacatcataacaacgcgttgt |
15559753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University