View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_high_35 (Length: 266)
Name: NF2880_high_35
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_high_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 97 - 253
Target Start/End: Complemental strand, 238052 - 237896
Alignment:
| Q |
97 |
cataagtatgtccggtgatggattggactattcaattgcatgcatgttgagagttcttctctctactagtgtgtgtccatttggtcatataccattattt |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
238052 |
cataagtatgtccggtgatggattagactattcaattgcatgcatgttgagagttcttctctctactagtgtgtgtccatttggtcatataccattattt |
237953 |
T |
 |
| Q |
197 |
gtaacacaaagtaagagagggtcaactctcatactctaagtctctaacgacaatctt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
237952 |
gtaacacaaagtaagagagggtcaactctcatactctaagtctctaacgacaatctt |
237896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 228980 - 229012
Alignment:
| Q |
222 |
ctctcatactctaagtctctaacgacaatcttc |
254 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
228980 |
ctctcatactctaagtctctaacaacaatcttc |
229012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University