View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_high_45 (Length: 217)
Name: NF2880_high_45
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_high_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 28520414 - 28520229
Alignment:
| Q |
16 |
atgaagggttatgtgaactcgcctatttttccaatatttttgctgccataattgtgagcaagaaccggttttacaagatgtccaaacttttctgaacatg |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
28520414 |
atgaggggttatgtgaactcgcctatttttccaatatttttgctgccataattgtgagcaagaaccgattttacaagatgtccaaacgtgtctgaacatg |
28520315 |
T |
|
| Q |
116 |
gaggataaccaaatgcttatcgctccttttaatgatgtcgagttttctgaagcaattaaacaaccaggctttgttgtaggaagatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||| ||||||||| |
|
|
| T |
28520314 |
gaggataaccaaatgcttatcgctccttttaatgatgtcgagttttctgaagcggttaaaaaatcaggctttgttgcaggaagatc |
28520229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University