View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_high_47 (Length: 206)
Name: NF2880_high_47
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 2556545 - 2556717
Alignment:
| Q |
19 |
atgaacccaataattattgaccaaggctacaaaattagtccaacggtacgtatttcactctacattattattcatattattatatcttgaacattagatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556545 |
atgaacccaataattattgaccaagggtacaaaattagtccaacggtacgtatttcactcaacattattattcatattattatatcttgaacattagatt |
2556644 |
T |
 |
| Q |
119 |
acttcactcttgattggttttacatatcgtagttacatacgagttgaatttttctaattaggatacatctgtg |
191 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
2556645 |
atttcactcttgattggttttacatatcatagttacatacgagttgaaattttttaattaggatacatctgtg |
2556717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 21 - 90
Target Start/End: Original strand, 2566404 - 2566473
Alignment:
| Q |
21 |
gaacccaataattattgaccaaggctacaaaattagtccaacggtacgtatttcactctacattattatt |
90 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2566404 |
gaacccaataattatagaccaaggatacaaaattagtccaacggtacatatttcactctacattattatt |
2566473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University