View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_low_35 (Length: 287)
Name: NF2880_low_35
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_low_35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 287
Target Start/End: Original strand, 33229214 - 33229482
Alignment:
| Q |
19 |
acaatgtgggttctccatcacctcagaggcttctcttgggaagcaaaagcattgataactctagctgcattctctttggagtatggtgcaattatgcatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33229214 |
acaatgtgggttctccatcacctcagaggcttctcttgggaagcaaaagcattgataactctagctgcattctctttggagtatggtgcaattatgcatc |
33229313 |
T |
 |
| Q |
119 |
ttcataggattcaatcatcagacacacttggaaactcattgaagcaacttagccaagttcaattcagaaaggttcctgccgatataactgaacttgtcac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33229314 |
ttcataggattcaatcatcagacacacttggaaactcattgaagcaacttagccaagttcaattcagaaaggttcctgccgatataactgaacttgtcac |
33229413 |
T |
 |
| Q |
219 |
attcttattgcaagtgttacaagacattaaaacttgtgcagcatggtctgctttcggttatgacttgga |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33229414 |
attcttattgcaagtgttacaagacattaaaacttgggcagcatggtctgctttcggttatgacttgga |
33229482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University