View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_low_38 (Length: 281)
Name: NF2880_low_38
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_low_38 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0140 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 36372 - 36635
Alignment:
| Q |
18 |
gtatcttgggcaatgttcatttcatatatgaagatgtagtgtaatgactcagttcaaatgttaaatcaatgttatgaagtttatgacattgttgattgta |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36372 |
gtattttgggcaatgttcatttcatatatgaagatgtagtgtaatgactcggttcaaatgttaaatcaatgttatgaagtttatgacattgttgattgta |
36471 |
T |
|
| Q |
118 |
atgaaaagaagttgtgtttcttgaataaatgaaatgaagtttgtttgtcatgctattgttgtctgcttgttcattactttgtgattcactgttaaagtaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36472 |
atgaaaagaagttgtgtttcttgaatcaatgaaatgaagtttgtttgtcatgctattgttgtatgcttgttcattagtttgtgattcactgttaaagtaa |
36571 |
T |
|
| Q |
218 |
tatgattatagttagcaaagttgtagacataattgtcttctttcataccaaaatgcaccaaaat |
281 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
36572 |
tatgattatagtaagcaaagttgtagtcataattatcttgtttcatagcaaaatgcaccaaaat |
36635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 23573679 - 23573754
Alignment:
| Q |
18 |
gtatcttgggcaatgttcatttcatatatgaagatgtagtgtaatgactcagttcaaatgttaaatcaatgttatgaa |
95 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| |||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
23573679 |
gtatcttgggcaatgttcattacatatctgacgatgtagtgtgat--ctcggttcaaatgttaaatcaatgttatgaa |
23573754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University