View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2880_low_40 (Length: 266)

Name: NF2880_low_40
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2880_low_40
NF2880_low_40
[»] chr6 (2 HSPs)
chr6 (97-253)||(237896-238052)
chr6 (222-254)||(228980-229012)


Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 97 - 253
Target Start/End: Complemental strand, 238052 - 237896
Alignment:
97 cataagtatgtccggtgatggattggactattcaattgcatgcatgttgagagttcttctctctactagtgtgtgtccatttggtcatataccattattt 196  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
238052 cataagtatgtccggtgatggattagactattcaattgcatgcatgttgagagttcttctctctactagtgtgtgtccatttggtcatataccattattt 237953  T
197 gtaacacaaagtaagagagggtcaactctcatactctaagtctctaacgacaatctt 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
237952 gtaacacaaagtaagagagggtcaactctcatactctaagtctctaacgacaatctt 237896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 254
Target Start/End: Original strand, 228980 - 229012
Alignment:
222 ctctcatactctaagtctctaacgacaatcttc 254  Q
    ||||||||||||||||||||||| |||||||||    
228980 ctctcatactctaagtctctaacaacaatcttc 229012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University