View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_low_44 (Length: 244)
Name: NF2880_low_44
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_low_44 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 39076846 - 39076603
Alignment:
| Q |
1 |
ctgatatgaatagaaccgggtttatggttaattcgcctgcgtttcttggccaaggttcgactttttccgcccatagggggacccttcagtccagtttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076846 |
ctgatatgaatagaaccgggtttatggttaattcgcctgcgtttcttggccaaggttcgactttttccgcccatagggggacccttcagtccagtttttc |
39076747 |
T |
|
| Q |
101 |
gccatcacttcgtccttggaatgatattccaattgcggatgcctcggtggatcatcatagtcacaagtctcaacaacaaattcaccaagcttctatcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076746 |
gccatcacttcgtccttggaatgatattccaattgcggatgcctcggtggatcatcataatcacaagtctcaacaacaaattcaccaagcttctatcttc |
39076647 |
T |
|
| Q |
201 |
ggtagcaggtttctgtctgatgctttgacaggtttctgtattcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076646 |
ggtagcaggtttctgtctgatgctttgacaggtttctgtattcc |
39076603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University