View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2880_low_53 (Length: 217)

Name: NF2880_low_53
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2880_low_53
NF2880_low_53
[»] chr8 (1 HSPs)
chr8 (16-201)||(28520229-28520414)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 28520414 - 28520229
Alignment:
16 atgaagggttatgtgaactcgcctatttttccaatatttttgctgccataattgtgagcaagaaccggttttacaagatgtccaaacttttctgaacatg 115  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||    
28520414 atgaggggttatgtgaactcgcctatttttccaatatttttgctgccataattgtgagcaagaaccgattttacaagatgtccaaacgtgtctgaacatg 28520315  T
116 gaggataaccaaatgcttatcgctccttttaatgatgtcgagttttctgaagcaattaaacaaccaggctttgttgtaggaagatc 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||| || |||||||||||| |||||||||    
28520314 gaggataaccaaatgcttatcgctccttttaatgatgtcgagttttctgaagcggttaaaaaatcaggctttgttgcaggaagatc 28520229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University