View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2880_low_54 (Length: 209)
Name: NF2880_low_54
Description: NF2880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2880_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 41216715 - 41216919
Alignment:
| Q |
1 |
ttggtttcctattattttcatgcacctttgccttacaattcaaaaacattttcagtgagatattttttagtattgattaa-----------cattgttaa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41216715 |
ttggtttcctattattttcatgcacctttgccttacaattcaaaaacattttcagtgagatattttttagtattgattaatatcgtctcgacattgttaa |
41216814 |
T |
|
| Q |
90 |
tatttcaaatgattatgaacttacagaataatgatcaagtttgtcactctctttccacataaaaacctaaatataaccattgatagtaaaagttgagtta |
189 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41216815 |
tgtttcaaatgattataaacttacagaataatgatcaagtttgtcactctctttccacataaaaacctaaatataaccattgatagtaaaagttgagtta |
41216914 |
T |
|
| Q |
190 |
gaagt |
194 |
Q |
| |
|
||||| |
|
|
| T |
41216915 |
gaagt |
41216919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University