View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2881_high_9 (Length: 331)

Name: NF2881_high_9
Description: NF2881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2881_high_9
NF2881_high_9
[»] chr3 (1 HSPs)
chr3 (5-315)||(4457852-4458161)


Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 5 - 315
Target Start/End: Complemental strand, 4458161 - 4457852
Alignment:
5 gaggagcgagatatggtatttttcttcttggacttctaggaaattagagaagggcacaaaaagacacaatatccagtaactgacttgcgagaatccaagc 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||  |||||||||||| ||||||||||||||||||||||||    
4458161 gaggagcgagatatggtatttttcttcttggacttctaggaaattagagaaggac-caaaagtacacaatatccaataactgacttgcgagaatccaagc 4458063  T
105 agcatgcctaatctgagtcggaaaaactagataaagacaatgaattgaaggtaggaaagaataacccctgagctggggcagatttgagatactttaatac 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4458062 agcatgcctaatctgagtcggaaaaactagataaagacaatgaattgaaggtaggaaagaataacccctgagctggggcagatttgagatactttaatac 4457963  T
205 tctgatggcagcttggaaataagtttcaagaggcttatgaacaaattgactaagttgttgtaaagggaatgcaatgtttgtcgttgtagtggttaggtat 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4457962 tctgatggcagcttggaaataagtttcaagaggcttatgaacaaattgactaagttgttgtaaagggaatgcaatgtttgtcgttgtagtggttaggtat 4457863  T
305 gataacctacc 315  Q
    |||||||||||    
4457862 gataacctacc 4457852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University