View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2881_low_10 (Length: 331)
Name: NF2881_low_10
Description: NF2881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2881_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 5 - 315
Target Start/End: Complemental strand, 4458161 - 4457852
Alignment:
| Q |
5 |
gaggagcgagatatggtatttttcttcttggacttctaggaaattagagaagggcacaaaaagacacaatatccagtaactgacttgcgagaatccaagc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4458161 |
gaggagcgagatatggtatttttcttcttggacttctaggaaattagagaaggac-caaaagtacacaatatccaataactgacttgcgagaatccaagc |
4458063 |
T |
 |
| Q |
105 |
agcatgcctaatctgagtcggaaaaactagataaagacaatgaattgaaggtaggaaagaataacccctgagctggggcagatttgagatactttaatac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4458062 |
agcatgcctaatctgagtcggaaaaactagataaagacaatgaattgaaggtaggaaagaataacccctgagctggggcagatttgagatactttaatac |
4457963 |
T |
 |
| Q |
205 |
tctgatggcagcttggaaataagtttcaagaggcttatgaacaaattgactaagttgttgtaaagggaatgcaatgtttgtcgttgtagtggttaggtat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4457962 |
tctgatggcagcttggaaataagtttcaagaggcttatgaacaaattgactaagttgttgtaaagggaatgcaatgtttgtcgttgtagtggttaggtat |
4457863 |
T |
 |
| Q |
305 |
gataacctacc |
315 |
Q |
| |
|
||||||||||| |
|
|
| T |
4457862 |
gataacctacc |
4457852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University