View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2881_low_14 (Length: 247)
Name: NF2881_low_14
Description: NF2881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2881_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 4458475 - 4458715
Alignment:
| Q |
1 |
ctaggcctttgtaatttacatagcccaaacttgagggagggtgttacttaacttaactggttatagttatttacttacactaaccattgttagttgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4458475 |
ctaggcctttgtaatttacatagcccaaacttgagggagggtgttacttaacttaactggttatagttatttacttacactaaccattgttagttgattt |
4458574 |
T |
 |
| Q |
101 |
attagttctagttagtacccaaattactacatagatta----nnnnnnnnnnnncacttggtactgttactgattactagaaaaacatttgtacactttt |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4458575 |
attagttctagttagtatccaaattactacatagattagtgtgtgtgtgtgtgtcacttggtactgttactgattactagaaaaacatttctacactttt |
4458674 |
T |
 |
| Q |
197 |
cactttatatttaatatgaagatgagtttattattcgctct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4458675 |
cactctatatttaatatgaagatgagtttattattctctct |
4458715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University