View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2881_low_17 (Length: 230)

Name: NF2881_low_17
Description: NF2881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2881_low_17
NF2881_low_17
[»] chr5 (3 HSPs)
chr5 (31-224)||(37082853-37083049)
chr5 (66-152)||(37074128-37074214)
chr5 (31-126)||(37076397-37076492)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 31 - 224
Target Start/End: Complemental strand, 37083049 - 37082853
Alignment:
31 gcaaacgatcaacgagttacacatgttcttaatcttcaaattcaagaaaggagggatatgtaactttaattgtgaacagggaaaagaatagttcttaatt 130  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
37083049 gcaaacgatcaacgagttacacatgttcttaatctccaaattcaagaaaggagggatatgtaactttaattgtgaacagggaaaagaatacttcttaatt 37082950  T
131 tgtggccattgttttgcacacgacaaaacataaataga---acaaaatacgtgagaccatgagagtgtgtgtactgtgtagggcatgatgtaactta 224  Q
    ||||||||||||||||||||||||||||||||||||||   |||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
37082949 tgtggccattgttttgcacacgacaaaacataaatagaacaacaaaagacgtgagaccatgagagtgtgtgtactgtgtagggcatgatgtaactta 37082853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 66 - 152
Target Start/End: Complemental strand, 37074214 - 37074128
Alignment:
66 tcaaattcaagaaaggagggatatgtaactttaattgtgaacagggaaaagaatagttcttaatttgtggccattgttttgcacacg 152  Q
    ||||| |||||||||||||||||||||||||||||||  ||||||| ||||||| |||||| | |||| || |||| ||||||||||    
37074214 tcaaaatcaagaaaggagggatatgtaactttaattggaaacaggggaaagaattgttcttgaattgtagcgattgatttgcacacg 37074128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 126
Target Start/End: Complemental strand, 37076492 - 37076397
Alignment:
31 gcaaacgatcaacgagttacacatgttcttaatcttcaaattcaagaaaggagggatatgtaactttaattgtgaacagggaaaagaatagttctt 126  Q
    ||||||||||||||||||   | || | |||||||| | | |||||||||||||||||||| ||||||||||||||||| | ||||||| ||||||    
37076492 gcaaacgatcaacgagtttatcgtgattttaatctttataatcaagaaaggagggatatgttactttaattgtgaacagaggaaagaattgttctt 37076397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University