View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2884_low_9 (Length: 255)
Name: NF2884_low_9
Description: NF2884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2884_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 17206055 - 17205874
Alignment:
| Q |
1 |
ttctcaggtaagaacaatagtacccactgtgacgtcacggtaaaattgtttccttgacgttgttttaccaacatgaattagatagtatgatctgcggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17206055 |
ttctcaggtaagaacaatagtacccactgtgacgtcacagtaaaattgtttccttgacgttgttttaccaacatgaattagatagtatgatctgcggata |
17205956 |
T |
 |
| Q |
101 |
atgagacgttg-agaacatccagctcttggtcaaggaactgcacacataagtgcaagctaagaaatgaaacaatcacaacaa |
181 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17205955 |
atgagacgttgcagaacatccagctcttggtcaaggaactgcacacacaagtgcaagctaagaaatgaaacaatcacaacaa |
17205874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University