View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-20 (Length: 305)
Name: NF2885-Insertion-20
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 58 - 270
Target Start/End: Original strand, 18245638 - 18245847
Alignment:
| Q |
58 |
aaagagtaccgggatttggaaagtgaagttgtgtataactcctgaaaagttgttagagattttgtcacaagaggtttcaaccaaggaattgattgagagt |
157 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
18245638 |
aaagagtactgggatttggaaagtgaaattgtgtataactcctgaaaagttgttggagattttgtcacaagaggtttcaaccaaggagttgatagagagt |
18245737 |
T |
|
| Q |
158 |
gtgaggattgtagccaaatgtggtgttgctactgctgcttctggtggtggttgtggaatttcatctacaacaagcattgcttctgatcaatggagtcttt |
257 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18245738 |
gtgaggattgtagccaaatgtggtgt---tactgctgcttcttctggtggttgtggaatttcatctacaacaagcattgtttctgatcaatggagtcttt |
18245834 |
T |
|
| Q |
258 |
ctagtagtggtag |
270 |
Q |
| |
|
||||||||||||| |
|
|
| T |
18245835 |
ctagtagtggtag |
18245847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 72 - 182
Target Start/End: Complemental strand, 44999978 - 44999868
Alignment:
| Q |
72 |
tttggaaagtgaagttgtgtataactcctgaaaagttgttagagattttgtcacaagaggtttcaaccaaggaattgattgagagtgtgaggattgtagc |
171 |
Q |
| |
|
||||||||||||||||| || | ||| ||| ||||| | || |||||| ||||||||| | ||| || || ||||| |||||||| ||||||||||| |
|
|
| T |
44999978 |
tttggaaagtgaagttggtgattagtccagaacagttgatggaaattttggcacaagaggctagaacaaaagagttgatagagagtgtaaggattgtagc |
44999879 |
T |
|
| Q |
172 |
caaatgtggtg |
182 |
Q |
| |
|
|||||||||| |
|
|
| T |
44999878 |
aaaatgtggtg |
44999868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University