View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-22 (Length: 237)
Name: NF2885-Insertion-22
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 237
Target Start/End: Complemental strand, 6320254 - 6320040
Alignment:
| Q |
23 |
tatcaagaagaatgatattaattaccagtgcagccatttgagcccatttatttcccatcttatgatgcaactcaatgattcggcgttcttcttcagcagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6320254 |
tatcaagaagaatgatattaattaccagtgcagccatttgagcccatttatttcccatcttatgatgcaactcaatgattcggcgttcttcttcagcagt |
6320155 |
T |
|
| Q |
123 |
aattgcaccctttctgagatcaggtctcaaatgatttgcccatcgtagacgacagcttttcccacagcgagcaagtccggtacatttccggactgaattc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6320154 |
aattgcaccctttctgagatcaggtctcaaatgatttgcccatcgtagacgacagcttttcccacagcgagcaagtccggtacatttccggactgaattc |
6320055 |
T |
|
| Q |
223 |
cagtttccctcacca |
237 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6320054 |
cagtttccctcacca |
6320040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University