View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-23 (Length: 230)
Name: NF2885-Insertion-23
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-23 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 6 - 230
Target Start/End: Original strand, 3958144 - 3958368
Alignment:
| Q |
6 |
caacgacaattgccaagagaaaacaatcatctttgaaggtgcaaagctttctttcaagaggaacgaattccctcattctcgaccacataatgagatggat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3958144 |
caacgacaattgccaagagaaaacaatcatctttgaaggtgcaaagctttctttcaagaggaacgaattccctcattctcgaccacataatgagatggat |
3958243 |
T |
|
| Q |
106 |
taggaatacatttgtctgacaataacaaatacaccaacttaacataatattgcacaccacccacccaactcaaacgccaagagtcctcttgatgtgagag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3958244 |
taggaatacatttgtctgacaataacaaatacgccaacttaacataatattgcacaccacccacccaactcaaacgccaagagtcctcttgatgtgagag |
3958343 |
T |
|
| Q |
206 |
ttgaatcgaagttagaacatcgata |
230 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
3958344 |
ttgaatcgaagttggaacatcgata |
3958368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University