View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-24 (Length: 147)
Name: NF2885-Insertion-24
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-24 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 147
Target Start/End: Complemental strand, 41539340 - 41539200
Alignment:
| Q |
8 |
taattagaggagtaatttgagtattaactcttaattggttatatttagacacggtataagtatcagtgatttggattgttgactt-ttttctttagagtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41539340 |
taattagaggagtaatttgagtattaactcttaattgattatatttagacacggtataagtatcagtgatttggattgttgactttttttctttagagtt |
41539241 |
T |
|
| Q |
107 |
ggaagaattatgataatgaaatttgctcattgattcatcga |
147 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41539240 |
ggaagtattatgataatgaaatttgctcattgattcatcga |
41539200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University