View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-25 (Length: 121)
Name: NF2885-Insertion-25
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 12268604 - 12268716
Alignment:
| Q |
8 |
gcaagctactcaatgcatgctaaaagggaggctcctttgtgggatatgtccaattggattgggaatgttggggttggaatgctatgtggaggagggggtt |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12268604 |
gcaagctactcaatgcatgctaggagggaggctcctttgtgggatatgtccaattggattgggaatgttgggtttggaatgctatgtggaggagggggtt |
12268703 |
T |
|
| Q |
108 |
gtttgtctggggg |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12268704 |
gtttgtctggggg |
12268716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University