View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-26 (Length: 132)
Name: NF2885-Insertion-26
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 129
Target Start/End: Original strand, 41204893 - 41205014
Alignment:
| Q |
8 |
aggctaagagaataatgcaaatttatagtatatttgtttgggtggaattggaattaaccaaattatgcttggtgttaaagaagattaatgtaattatcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41204893 |
aggctaagagaataatgcaaatttatagtatatttgtttgggtggaattggaattaaccaaattatgcttggtgttaaagaagattaatgtaattatcaa |
41204992 |
T |
 |
| Q |
108 |
tttatcgttgtcaacaaagttg |
129 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
41204993 |
tttatcgttgtcaacaatgttg |
41205014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University