View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2885-Insertion-30 (Length: 80)

Name: NF2885-Insertion-30
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2885-Insertion-30
NF2885-Insertion-30
[»] chr6 (2 HSPs)
chr6 (11-80)||(5636595-5636664)
chr6 (35-71)||(3165489-3165525)
[»] chr2 (1 HSPs)
chr2 (15-71)||(38734219-38734275)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 11 - 80
Target Start/End: Complemental strand, 5636664 - 5636595
Alignment:
11 ccaatgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtttaaacacca 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||    
5636664 ccaatgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcacagtgattttgcttaaacacca 5636595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 3165489 - 3165525
Alignment:
35 gagtttgaaaaaatcatgatggcaccgtgattttgtt 71  Q
    |||||||| |||||||||||| |||||||||||||||    
3165489 gagtttgacaaaatcatgatgacaccgtgattttgtt 3165525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 38734219 - 38734275
Alignment:
15 tgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtt 71  Q
    ||||||||| |||  ||||||||||||| |||||||  |||||||| ||||||||||    
38734219 tgcatgtttagattgacggtgagtttgacaaaatcaccatggcaccatgattttgtt 38734275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University