View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885-Insertion-30 (Length: 80)
Name: NF2885-Insertion-30
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885-Insertion-30 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 11 - 80
Target Start/End: Complemental strand, 5636664 - 5636595
Alignment:
| Q |
11 |
ccaatgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtttaaacacca |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
5636664 |
ccaatgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcacagtgattttgcttaaacacca |
5636595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 3165489 - 3165525
Alignment:
| Q |
35 |
gagtttgaaaaaatcatgatggcaccgtgattttgtt |
71 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
3165489 |
gagtttgacaaaatcatgatgacaccgtgattttgtt |
3165525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 38734219 - 38734275
Alignment:
| Q |
15 |
tgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtt |
71 |
Q |
| |
|
||||||||| ||| ||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
38734219 |
tgcatgtttagattgacggtgagtttgacaaaatcaccatggcaccatgattttgtt |
38734275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University