View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885R-Insertion-8 (Length: 256)
Name: NF2885R-Insertion-8
Description: NF2885R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885R-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 256
Target Start/End: Complemental strand, 47626002 - 47625755
Alignment:
| Q |
9 |
gcaattccacgtgaaaaaagtttggatgttcgatccgaggattaatcttatggcaggctcaaagagtctaagccataaagatattttggcgcgcttacta |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626002 |
gcaattccacgagaaaaaagtttggatgttcgatccgaggattaatcttatggcaggctcaaagagtctaagccataaagatattttggcgcgcttacta |
47625903 |
T |
|
| Q |
109 |
gggtcaaagatgctaattatggattaatagaaacatcatataaataaactaacccttagttgttgctgctgctgctgaggtctctgaatgctgataaaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47625902 |
gggtcaaagatgctaattatggattaatagaatcatcatataaataaactaacccttagttgttgttgctgctgctgaggtctctgaatgctgataaaac |
47625803 |
T |
|
| Q |
209 |
ggataagtttcaaacctaacaaaacaacttggaaagaaaacagtttcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625802 |
ggataagtttcaaacctaacaaaacaacttggaaagaaaacagtttcc |
47625755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University