View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2885_high_3 (Length: 283)
Name: NF2885_high_3
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2885_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 20 - 277
Target Start/End: Complemental strand, 47626002 - 47625745
Alignment:
| Q |
20 |
gcaattccacgtgaaaaaagtttggatgttcgatccgaggattaatcttatggcaggctcaaagagtctaagccataaagatattttggcgcgcttacta |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626002 |
gcaattccacgagaaaaaagtttggatgttcgatccgaggattaatcttatggcaggctcaaagagtctaagccataaagatattttggcgcgcttacta |
47625903 |
T |
 |
| Q |
120 |
gggtcaaagatgctaattatggattaatagaaacatcatataaataaactaacccttagttgttgctgctgctgctgaggtctctgaatgctgataaaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47625902 |
gggtcaaagatgctaattatggattaatagaatcatcatataaataaactaacccttagttgttgttgctgctgctgaggtctctgaatgctgataaaac |
47625803 |
T |
 |
| Q |
220 |
ggataagtttcaaacctaacaaaacaacttggaaagaaaacagtttcccctatgctac |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625802 |
ggataagtttcaaacctaacaaaacaacttggaaagaaaacagtttcccctatgctac |
47625745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University