View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2885_high_7 (Length: 233)

Name: NF2885_high_7
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2885_high_7
NF2885_high_7
[»] chr1 (1 HSPs)
chr1 (19-131)||(31694327-31694439)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 31694439 - 31694327
Alignment:
19 gaaggtggtagcggatgatgtgtgggggttatggaatgtgattgaggtgaattacaagggtaaaaatacactgataattaaggaaatttatgaggttgaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||||||||     
31694439 gaaggtggtagcggatgatgtgtgggggttatggaatgtgattgaggtgaattacaagggtaactatacactgataattaaggaaatctatgaggttgag 31694340  T
119 ataaggggtcgta 131  Q
    |||||||||||||    
31694339 ataaggggtcgta 31694327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University