View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2885_low_8 (Length: 232)

Name: NF2885_low_8
Description: NF2885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2885_low_8
NF2885_low_8
[»] chr3 (1 HSPs)
chr3 (1-232)||(30634113-30634344)


Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 30634113 - 30634344
Alignment:
1 caattcccaacaaatctgaatttccaaatgtgaaacaatataccaaatcattactatgattattattcccttttaatgccacgtcagcaactttatataa 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30634113 caattcccaacaaatctgaatttccaaacgtgaaacaatataccaaatcattactatgattattattcccttttaatgccacgtcagcaactttatataa 30634212  T
101 tagtctctcacctgaaacactcatctccgccccttcaaacacaagtgtcaccgccggtaacggcggaagaaccgaacccgacccgatacggtaacacaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||    
30634213 tagtctctcacctgaaacactcatctccgccccttcaaacacaagtgtcaccgccggtaacgttggaagaaccgaacccgacccgatacggtaacacaaa 30634312  T
201 tccattgcaccttggaagacaaaattcgtgtc 232  Q
    |||||||||||||||||||||||||| |||||    
30634313 tccattgcaccttggaagacaaaatttgtgtc 30634344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University