View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2886_high_5 (Length: 228)
Name: NF2886_high_5
Description: NF2886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2886_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 6 - 138
Target Start/End: Complemental strand, 1036902 - 1036770
Alignment:
| Q |
6 |
attgacatggtttcttattgatatatttcatttcaaaagatattgtagaacaagcttgtgaaactctagtgttgaatcatgatcaagttgaaatgtttat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036902 |
attgacatggtttcttattgatatatttcatttcaaaagatattgtacaacaagcttgtgaaactctagtgttgaatcatgatcaagttgaaatgtttat |
1036803 |
T |
 |
| Q |
106 |
aagatttgatttactacgctattgtatcatact |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1036802 |
aagatttgatttactacgctattgtatcatact |
1036770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University