View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2886_low_2 (Length: 314)
Name: NF2886_low_2
Description: NF2886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2886_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 10911750 - 10911659
Alignment:
| Q |
18 |
ggaagcagaatcaccaacaagacagatatcaatggcggcgatatcgaggtgaacagcagaagggtaatcataagcagtgaccattgtgattg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10911750 |
ggaagcagaatcaccaacaagacagatatcaatggcggccatatcgaggtgaacagcagaagggtaatcataagcagtgaccattgtgattg |
10911659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 173 - 288
Target Start/End: Complemental strand, 10911595 - 10911483
Alignment:
| Q |
173 |
gacctgtgtatactgtgttttctgggagattgctcatgttacggagaagagatgttgaacgttgaagggttgttgttgttgctttcagtattgatcttag |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
10911595 |
gacctgtgtatactgtgttttctgggagattgctcatgttacggagaagagatgatgaacgatgaagg---gtttttgttgctttcagcattgatcttag |
10911499 |
T |
|
| Q |
273 |
aattgccatggttgct |
288 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10911498 |
aattgccatggttgct |
10911483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 173 - 287
Target Start/End: Original strand, 13724590 - 13724706
Alignment:
| Q |
173 |
gacctgtgtatactgtgttttctgggaga--ttgctcatgttacggagaagagatgttgaacgttgaagggttgttgttgttgctttcagtattgatctt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||| |||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
13724590 |
gacctgtgtatactgtgttttctgggagagattgctcatgttacagagaaaagatgatgaacgatgaagggttgtttttgttgctttcgttattgatctt |
13724689 |
T |
|
| Q |
271 |
agaattgccatggttgc |
287 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13724690 |
agaattgccatggttgc |
13724706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 13733027 - 13733118
Alignment:
| Q |
18 |
ggaagcagaatcaccaacaagacagatatcaatggcggcgatatcgaggtgaacagcagaagggtaatcataagcagtgaccattgtgattg |
109 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13733027 |
ggaagcagaatcaccaacaagagatatatcaatggcggccatatcgaggtgaacagcagaagggtaatcataaacagtgaccattgtgattg |
13733118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 13724435 - 13724526
Alignment:
| Q |
18 |
ggaagcagaatcaccaacaagacagatatcaatggcggcgatatcgaggtgaacagcagaagggtaatcataagcagtgaccattgtgattg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13724435 |
ggaagcagaatcaccaacaagacagatatcaatggctttcatatcgtggtgaacagcagaagggtaatcataagcagtgaccattgtgattg |
13724526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University