View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2887-Insertion-11 (Length: 277)
Name: NF2887-Insertion-11
Description: NF2887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2887-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 56 - 277
Target Start/End: Original strand, 961728 - 961949
Alignment:
| Q |
56 |
gatcacttaacttatcatttaagttatgaaatttagacattctaatcatatctattagagatgaaaatgtcttaatatttataatttaagggatcaaagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
961728 |
gatcacttaacttatcatttaagttatgaaatttagacattctaatcatatctattagagatgaaaatgtcttaatatttataatttaagggatcaaagt |
961827 |
T |
 |
| Q |
156 |
gttcataactcaagaaaccaaaattaaacnnnnnnnncttaggaccaggttgtatgatacttgtaacttaactgaccgaaatgaaagaaaacatacttaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
961828 |
gttcataactcaagaaaccaaaattaaacaaaaaaaacttaggaccaagttgtatgatacttgtaacttaactgaccgaaatgaaagaaaacatacttaa |
961927 |
T |
 |
| Q |
256 |
aggaacaaaaatgtaatttaac |
277 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
961928 |
aggaacaaaaatgtaatttaac |
961949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University