View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2887_high_4 (Length: 363)
Name: NF2887_high_4
Description: NF2887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2887_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 35702513 - 35702773
Alignment:
| Q |
18 |
gtaaatttagaat-atatgattataattattaattaaagttgaatgatttgcaaccctggatcagaatggaaagtcctcggtctgtgaacagtccaagaa |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35702513 |
gtaaatttagaattatatgattataattattaattaaagttgaatgatttgcaaccctggatcagaatggaaagtcctcggtctgtcaacagtccaagaa |
35702612 |
T |
|
| Q |
117 |
gaacactgagtctttcaagaaagcggagggcaactgtgtcatttcttgattccgatgacaaaaacaactctgcctctgctttgtctgctgatcatggccc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35702613 |
gaacactgagtctttcaagaaagcggagggcgactgtgtcatttcttgattccgatgacaaaaacaactctgcctctgctttgtcagctgatcatggccc |
35702712 |
T |
|
| Q |
217 |
taaaccttctgaagtttacggtttcgttggatctataactaccgttgttgctacaggtttt |
277 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702713 |
taaaccttctgaagtttacggttttgttggatctataactaccgttgttgctacaggtttt |
35702773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 85 - 277
Target Start/End: Original strand, 7955461 - 7955653
Alignment:
| Q |
85 |
ggaaagtcctcggtctgtgaacagtccaagaagaacactgagtctttcaagaaagcggagggcaactgtgtcatttcttgattccgatgacaaaaacaac |
184 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
7955461 |
ggaaagtcctcggtctgtcaacagtccaagaagaacactgagtctatcgagaaagcggagggcaactgtgtcatttctcgattccgatgataaaaacaac |
7955560 |
T |
|
| Q |
185 |
tctgcctctgctttgtctgctgatcatggccctaaaccttctgaagtttacggtttcgttggatctataactaccgttgttgctacaggtttt |
277 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7955561 |
tctgcctctggtttgtcaagggatcatggccctaagccttctgaagtttacggtttcgttggatctataactaccgttgttgctacaggtttt |
7955653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 309 - 363
Target Start/End: Original strand, 35702925 - 35702980
Alignment:
| Q |
309 |
ttcctgtggcattttgtt-atttatactttgttcgttttcctttgtgaatagttat |
363 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35702925 |
ttcctgtggcattttttttatttatactttgttcattttcctttgtgaatagttat |
35702980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 17154 times since January 2019
Visitors: 1191