View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2887_high_8 (Length: 239)
Name: NF2887_high_8
Description: NF2887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2887_high_8 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 961682 - 961444
Alignment:
Q |
17 |
aaaaaacttaagaaaccaagttatgtagcatttgtgatttaagtggctaaaataaaatgnnnnnnnctcggggtctagtggtttttcactaacacttata |
116 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
961682 |
aaaaaacttaagaaaccaagttatgtagcatttgtaatttaagtggctaaaataaaatgaaaaaaactcggggtctagtggtttttcactaacacttata |
961583 |
T |
|
Q |
117 |
ggaatatttacttttgt--caatctttcaataatttgttctccttttgggcttttctcatccttcatataacaacaaaa--------------tacagtg |
200 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
961582 |
ggaatatttacttttgtgtcaatctttcaataatttgttctccttttgggcttttctcatccttcatataacaacaaaatacgtgaaggaaagtacagtg |
961483 |
T |
|
Q |
201 |
aaagaattaaacttggggcaaaaatattcgaatttccct |
239 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
961482 |
aaagaattaaacttggggcaaaaatattcaaatttccct |
961444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18079 times since January 2019
Visitors: 1266