View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2887_low_8 (Length: 295)
Name: NF2887_low_8
Description: NF2887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2887_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 32089761 - 32089516
Alignment:
| Q |
6 |
aagatgaagactcttatggatgcgtaagattttgttttagtggatatttaatcttttaacttgcttaaaaattaactgcagcactaagcatcgagtaaga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32089761 |
aagatgaagactcttatggatgcgtaagattttgttttagtggatatttaatcttttaacttgcttaaaaattaactgcagcactaagcatcgagtaaga |
32089662 |
T |
|
| Q |
106 |
cacaaattgtgagtgaatcattatgaaaaatagggaaagggacactccagctttagtttaaatagaggatcacactcttgtatcctgtgtggcaaagcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32089661 |
cacaaattgtgagtgaatcattatgaaaaatagggaaagggacactccagctttagtttaaatagaggatcacactcttgtatcctgtgtggcaaagcaa |
32089562 |
T |
|
| Q |
206 |
cataaatcctttcccttaacatactttggctctctttatagaaatc |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32089561 |
cataaaccctttcccttaacatactttggctctctttataggaatc |
32089516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 6 - 191
Target Start/End: Complemental strand, 32095661 - 32095476
Alignment:
| Q |
6 |
aagatgaagactcttatggatgcgtaagattttgttttagtggatatttaatcttttaacttgcttaaaaattaactgcagcactaagcatcgagtaaga |
105 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||| |||||||||||| ||||||||||||||||| | || |||||||||||| |||||||| |
|
|
| T |
32095661 |
aagacgaagactcttatgaatgtgtaagattttgttttagtgaatatttaatcttgtaacttgcttaaaaattgagtggagcactaagcattgagtaaga |
32095562 |
T |
|
| Q |
106 |
cacaaattgtgagtgaatcattatgaaaaatagggaaagggacactccagctttagtttaaatagaggatcacactcttgtatcct |
191 |
Q |
| |
|
||||| ||||||| |||||| ||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32095561 |
cacaagttgtgagcgaatcagtatgaaaaataggcaaagggactctccagctttagtataaatagaggatcacactcttgtatcct |
32095476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 229 - 293
Target Start/End: Complemental strand, 32095477 - 32095413
Alignment:
| Q |
229 |
ctttggctctctttatagaaatcttgctgtctggagaccatgctttcacgttgttaattaattta |
293 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
32095477 |
ctttggttctctttatagaaatcttgctgtgtagaggccatgctttcacgttgttaattaattta |
32095413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1836 times since January 2019
Visitors: 8839