View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2887_low_9 (Length: 283)
Name: NF2887_low_9
Description: NF2887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2887_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 9439713 - 9439510
Alignment:
| Q |
1 |
ttattttttggagacatgattaggttgactaactgcatttgtgaatcataggagtgagaaagtatttggatagtaagaaaaaggtagaagaaaaccagag |
100 |
Q |
| |
|
|||||| ||||||||||||||| ||| | ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9439713 |
ttatttgttggagacatgattatgttcgcaaactgcatttgtgaatcataggagtgacaaagtatttggatagtaagcaaaaggtagaagaaaaccagag |
9439614 |
T |
|
| Q |
101 |
gttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcctcttccactctcccactttcttcttataatttttgcgaattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
9439613 |
gttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcctcttccactctcccactttcttcatataattcttgcgaattc |
9439514 |
T |
|
| Q |
201 |
cctc |
204 |
Q |
| |
|
|||| |
|
|
| T |
9439513 |
cctc |
9439510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 272
Target Start/End: Complemental strand, 9439512 - 9439483
Alignment:
| Q |
243 |
ctccgagggaatatctggtctaaaattctt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9439512 |
ctccgagggaatatctggtctaaaattctt |
9439483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 498 times since January 2019
Visitors: 8655