View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-25 (Length: 358)
Name: NF2888-Insertion-25
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-25 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 124 - 358
Target Start/End: Original strand, 35420987 - 35421220
Alignment:
| Q |
124 |
gtgttgttggatcttctgtgtttctgttagcaactattgttgttgtttttgaggctgaacaacccatgtttaagttaagaaaattgggttgtgtttactt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35420987 |
gtgttgttggatcttctgtgtttctgttagcaactattgttgttgtttttgaggctgaacaacccatgtttaagttaagaaaattgggttgtgtttactt |
35421086 |
T |
 |
| Q |
224 |
ttgcaacctctctctagaatagaaaagataccnnnnnnnnnnnnnnnnnnnnggtgggtgaatttctattttagaggaccattttgcactaatgaatgat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35421087 |
ttgcaacctctctctagaatagaaaagatacctttttatatttttattttttggtgggtgaatttctattttagaggaccattttgcactaatgaatgat |
35421186 |
T |
 |
| Q |
324 |
tgttcttatgaggaagaggatttgtataggtatta |
358 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
35421187 |
tgttcttatgaggaagagga-atgtataggtatta |
35421220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 35420871 - 35420912
Alignment:
| Q |
8 |
gataagaggcattgtaagggacaaagcttttctaactggtgg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35420871 |
gataagaggcattgtaagggacaaagcttttctaactggtgg |
35420912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University