View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-28 (Length: 240)
Name: NF2888-Insertion-28
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 41941060 - 41940821
Alignment:
| Q |
8 |
taaaccgtatactcatgccttcttt--------gtatatatgagttatacttcaacgactaccttcgttaagttactctctctaagtttaaaccacatga |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41941060 |
taaaccgtatactcatgccttctttaatgtcttgtatatatgagtcatacttcaacgactaccttcgttaagttactctctctaagtttaaaccacatga |
41940961 |
T |
 |
| Q |
100 |
aagcttataaatgcaatatggttcctctacttattgtacatctattttatatgaaacatgattttggtctctttatttaaatcttagatgttgatgttcc |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41940960 |
aagcttataaatgcaatatggttcatctacttattgtacatctattttatatgagacatgattttggtctctttatttaaatcttagatgttgatgttcc |
41940861 |
T |
 |
| Q |
200 |
aatttcacaagttttagtagttttctccactttggtgctta |
240 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41940860 |
aatttcacaagttttagtag-tttcttcactttggtgctta |
41940821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University