View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-29 (Length: 272)
Name: NF2888-Insertion-29
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-29 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 272
Target Start/End: Original strand, 15883192 - 15883456
Alignment:
| Q |
8 |
aaaaggatggtgatgaaggttcatcaaggattaattatcaacaaaatgaaatggtcccacttgatttctctnnnnnnnnttgttcaaaatctgaggctaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15883192 |
aaaaggatggtgatgaaggttcatcaaggattaattatcaacaaaatgaaatggtcccacttgatttctctaaaaaaatttgttcaaaatctgaggctaa |
15883291 |
T |
|
| Q |
108 |
taagattttggttgaagaaaatattgatggtgatgaagatgaaattgtggatgaccaattgaggtgtctaagaaaattgataccaggtggagaagagatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15883292 |
taagattttggttgaagaaaatattgatggtgatgaagatgaaattgtggatgaccaattgaggtgtctaagaaaattgataccaggaggagaagagatt |
15883391 |
T |
|
| Q |
208 |
atatgtgatgaggaaatggtgaatgaattagagagctatgtaagttgtttgcaaatgcaggtgaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15883392 |
atatgtgatgaggaaatggtgaatgaattagagagctatgtaagttgtttgcaaatgcaggtgaa |
15883456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University