View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2888-Insertion-30 (Length: 246)
Name: NF2888-Insertion-30
Description: NF2888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2888-Insertion-30 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 27 - 246
Target Start/End: Complemental strand, 39788403 - 39788184
Alignment:
| Q |
27 |
aaatgactaaccgattccaccggagaaccataaaacacacacaaggcatcactataatttacaaaggacacacattatgtgactatgatcaatcaaattt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39788403 |
aaatgactaaccgattccaccggagaaccataaaacacacacaaggcatcactataatttacaaaggacacacattatgtgactatgattaatcaaattt |
39788304 |
T |
|
| Q |
127 |
agacttttcattatatctgaatcgattaaaataaaaactgcaaatcacacaaggattaagagtttgtccaagaggtgtcagctctgtagtgagaacttgg |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39788303 |
agacttgtcattatatctgaatcgattaaaataaaaactgcaaatcacacaaggattaagagtttgtccaagaggtgtcagctctgtagtgagaacttgg |
39788204 |
T |
|
| Q |
227 |
tcttataatatcaacagatg |
246 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39788203 |
tcttataatatcaacagatg |
39788184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University